jeovanyprobles jeovanyprobles

19-05-2021
Mathematics

contestada

Which measures could be the side lengths of a right triangle?

3 cm, 5 cm, 7 cm

7 cm, 9 cm, 12 cm

6 cm, 8 cm, 10 cm

5 cm, 12 cm, 14 cm

Respuesta :

naruteamshippuden naruteamshippuden

20-05-2021

Answer:

None of the above

Step-by-step explanation:

Cause triangles two shapes are same and on the bottom

Answer Link

Otras preguntas

what is the area of the top surface of a circular manhole cover that has a radius of 30cm

How did the progressive presidents foster the rise of the nation-state?

What two gasses probably dominated Precambrian Earth's atmosphere

convert 13542 base six to base ten. I'm in math20 at Folsom Lake College and i'm trying to figure out this question. I had most of the answers figured out but t

Which of the following is a true statement about South Africa? A. European mistreatment of Africans resulted in hundreds of years of conflict and violence. B. U

what action describes what people of similar interest do online to converse?a.) grabar un disco compacto b.) visitar salones de chatc.) bajar una canciond.) nav

Need help plz answer correctly Will mark brainlest What decimal is equal to 40%. 0.04% 0.4% 4 400 What fraction is equal to the decimal 0.8 In simplest f

Renting provides _________ flexibility but can lead to _________ costs in the long-term.

Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3

The repeal of this legislation kept employers from recruiting foreign workers