hdiaz931 hdiaz931

22-02-2017
Biology

contestada

Part 1: CCATAGCACGTTACAACGTGAAGGTAA
Convert it into RNA
List Amino Acids and do the same with
CCGTAGCATGTTACAACGCGAAGGCAC
thanks :3

Respuesta :

dana1321 dana1321

23-02-2017

RNA--GGUAUCGUGCAAUGUUGCACUUCCAUU

Answer Link

Otras preguntas

Who knows the book Rose Blanche

Who knows the book Rose Blanche

Who knows the book Rose Blanche

How to make money quickly

The coordinates of the vertices of ANGLE PQR are P(-3,3), Q(2,3), and R(-3,-4). Find the side lengths to the nearest hundredth and the angle measures to the nea

Your model locomotive is 16 inches long. It is an exact model of a locomotive that is 40 feet long. A window on the locomotive is how many times wider than a wi

How to make money quickly

Your model locomotive is 16 inches long. It is an exact model of a locomotive that is 40 feet long. A window on the locomotive is how many times wider than a wi

Your model locomotive is 16 inches long. It is an exact model of a locomotive that is 40 feet long. A window on the locomotive is how many times wider than a wi

How to make money quickly