18-09-2016
Mathematics

contestada

What is 81 to the power of 0.5?

Respuesta :

Аноним Аноним

18-09-2016

it would be 40.5 or 40 1/2

Answer Link

Olyalhic Olyalhic

18-09-2016

9

0.5 means you can write the problem out like this 1/(81)^(1/2)=1/9

meaning 1 part of 81 would be 9

9x9 = 81

Answer Link

Otras preguntas

Need help please. 15 points?

Speculating What do you think caused Ignatius to give up the military and adopt a holy life?

Please help i’m in 8th grade and this is the last day to turn in all my assignments.

When the frequency of a wave increases, what happens to the wavelength? It increases It disappears It does not change It decreases

Which of the sets of ordered pair represents a function?

Q6) Make a timeline of dynasties of the subcontinent.

describe what you would experienced or seen in the city of turpan

For each question in this doctor–patient interaction, identify whether the question is an open-ended question or a closed-ended question. What symptoms have you

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

A conference is ordering gift bags for each attendee. The cost will be $14.50 per bag plus a $80 set-up fee. If the total exceeds $500 there is a discount. How