figueroamelany316 figueroamelany316

19-12-2020
Biology

contestada

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Respuesta :

raduoprea160 raduoprea160

19-12-2020

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Answer Link

Otras preguntas

What are some government recommendations for daily physical activity?

An angle measures 12° less than the measure of a complementary angle. what is the measure of each angle?

F(x) = 5x + 7, g(x) = x + 9. Find f(g(x)). Can someone please just explain to me how you would go about solving a problem like this? I’m confused.

How do you do this problem?

Mr. Thornton's class visited five freshwater lakes to learn more about the crocodiles and alligators living in them to class counted the number of species in ea

Pls help will mark brainliest

Water reabsorption through the proximal convoluted tubule is termed obligatory water reabsorption, whereas water reabsorption through the distal convoluted tubu

the first union victory of the civil war came at?

What pattern do you notice

lois is paid 245 per week plus a 12% commission on all sales. His gross pay was $1320 last week.what was her amount of total sales?