anonymous200305
anonymous200305 anonymous200305
  • 19-05-2020
  • Mathematics
contestada

Need help asap pls ​

Need help asap pls class=

Respuesta :

alistersuares
alistersuares alistersuares
  • 19-05-2020

Answer:

the answare is infinty

Step-by-step explanation:

Answer Link

Otras preguntas

Which of the following is NOT a risk factor for heart disease? A. Obesity B. breed of animal C. kidney disease D. Bladder stones
A store is having a 20 percent off sale on all merchandise. If Mai buys one item and saves $13, what was the original price of her purchase? Explain or show you
The second angle of a triangle is twice as large as the first, and the third is three times as large as the first. Find the measure of each angle.
-1.2w=9//////.........................
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Draw a rectangular prism with length 8 feet, width 5 feet, and height 3 1/2 feet. Imagine this rectangular prism is full of water. Now draw a second rectangular
can anybody please help me!!
The table below shows the total development costs and amount of land required for different sized houses. Size of house 1 Bedroom 2 Bedroom 3 Bedroom 4 Bedroom
how would you describe the power dynamic between Europeans and Africans?
what technique did martin Luther king use in each line of his full speech?