kohlercarson907 kohlercarson907
  • 18-06-2019
  • Social Studies
contestada

Initiative and referendum process

Respuesta :

kinfox02
kinfox02 kinfox02
  • 18-06-2019

Answer:

Initiative. In political terminology, the initiative is a process that enables citizens to bypass their state legislature thus placing proposed statutes. in some states constitutional amendments on the ballot. In the direct process, proposals that qualify go directly on the ballot.

Answer Link

Otras preguntas

After Duncan’s murder how are Macbeth and Lady Macbeth alike
Describe how you would convince a friend that sin(x + y) does not equal sin x + sin y.
correct answer pleasefind the answer choices​
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
PLZ HELP DO NUMBER 8
how do i find b in this​
What’s one good piece of evidence here? First one gets marked as brainliest!❤️
1) Students who purchase tickets to the football game in advance receive 10% off the regular admission price. Roberto paid a discounted price of $6.30. He wants
Which factor drives nomadic movement?
If you could answer any it would be deeply appreciated.