cheyenne21 cheyenne21

20-04-2018
Mathematics

contestada

all of the following are equivalent expect

A. 8x+3x
B. (8+3)x
C. 11x
D. 11x2

Respuesta :

choixongdong choixongdong

20-04-2018

A. 8x+3x = 11x
B. (8+3)x = 11x
C. 11x = 11x
D. 11x^2 = 11x^2

answer

D. 11x^2

Answer Link

Otras preguntas

What is the main idea of the story of target rock

How was Christianity spread throughout the continent of Africa? A trading B Bantu migration C missionaries D animism

Use the restriction enzyme EcoRi to cut DNAVictim DNA : GGAAG ATTCTACATTACTGACGGACGTGACGTGA CCTTCTTAA GATGTAATGACTGCCTGCACTGACT Number of restriction fragments

Maya's test score average decreased by 18 points this semester. Write a signed number to represent this change in average.

Lisa is putting 29 juice bottles into coolers for a picnic. Each cooler holds 6 juice bottles How many coolers will Lisa need to hold all the juice bottles?

It is an advantage for two species to share the same niche.

I not get up early in simple past

In the solar system, most asteroids are ____. (A). Beyond Neptune (B). Orbiting Saturn (C). Between Mars and Jupiter (D). Next to the sun True of false: An obje

anybody have good jokes??

Find the length of the segment given the points (-9, 2) and (5, -4)