paula38
paula38 paula38
  • 17-04-2018
  • Mathematics
contestada

Please help me I don’t understand

Please help me I dont understand class=

Respuesta :

zannybear12 zannybear12
  • 17-04-2018
The answer is 7/12 in simplest form.
Answer Link
pathiencethezeb
pathiencethezeb pathiencethezeb
  • 17-04-2018
You would need to line them up first. Then find a common denominator. After that add the numerators together. The answer is 7/12.
Answer Link

Otras preguntas

If the first equation is multiplied by 3 and then the equations are added, the result is _____. 3x + y = 3 x - 3y = -2 10 x = 7 10 x = 11 8 x = 7
HELP PLS ASAP A stone is thrown horizontally from the top of a 18.4 m tall cliff. The stone lands at a distance of 22.3 m from the edge of the cliff. What is t
when to stop using gauze after wisdom tooth extraction?
How do the types and numbers of atoms that repeat to make up a substance affect its properties? (I cant find science so chemistry is gonna have to work) Middle
figurative language examples used in the book Hide and Seek by Ida Vos
The area of a rectangular ink pad is 32 square centimeters. The perimeter is 24 centimeters. What are the dimensions of the ink pad?
Transribe and translate the following dna strand GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT
Why did the US drop a nuclear bomb on Japan?
what is the empirical formula for C4O8
8x11=(8x10)+(1x10) what is the answer