kimmy74 kimmy74
  • 18-01-2018
  • Mathematics
contestada

What the answer to this problem

What the answer to this problem class=

Respuesta :

theMCcm theMCcm
  • 18-01-2018
1 - 2x * 3x^4
Multiply the -2 and the 3 to get -6, and multiply x by x^4, which is x^5.
1 -6x^5

Final Answer: -6x^5+1
Answer Link

Otras preguntas

Transribe and translate the following dna strand GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT
What is the difference between an expression and a statement in Python? Explain your answer
Which statement best completes the explanation of how word choice supports the tone of the passage? Describing what Jenny faces when she gets home with the word
The pages of a book are numbered 1 to 200 and each leaf is 0.10 mm thick. If each cover is 0.20mm thick . what is the thickness of the book
please help me with this​
A 400 g sample is composed of 100 g of cesium (Cs) and 300 g of iodine (1). What is the percent by mass of Cs in the sample? A. 50.0% B. 70.0% C. 25.0% D. 75.0%
Which table shows a proportional relationship between x and y? x 40 50 60 90 y 8 10 14 18 x 1 2 3 4 y 6 8 10 12 x 2 4 7 8 y 6 10 21 24 x 4 7 8 10 y 2 3.5 4 5
Why do you think it is important to study genetics
Write an equation of the line containing the given point and parallel to the given line. (7.-5); 4x - 5y = 2
Why is -3 a solution to 1 over 3x - 6 = -7