mariahjoparker mariahjoparker

21-04-2017
Business

contestada

12. Antitrust laws keep businesses from _____.

A. acting like monopolies
B. selling a lot of imports
C. producing exported goods

Respuesta :

blessedcboriginal blessedcboriginal

21-04-2017

hm I would say (A)...

Answer Link

anonymous3219 anonymous3219

28-04-2017

A. acting like monopolies

Answer Link

Otras preguntas

Which is an advantage of sexual reproduction over asexual reproduction? increased number of organisms and decreased genetic variation increased genetic variatio

What is the formula of sodium bicarbonate

Eighteen-year-old bianca is an unmarried, white american high school senior. bianca is experiencing a major depressive episode and her depression is at its lowe

Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

Explain whether you think judy's family occurrences of breast and ovarian cancers are sporadic, hereditary, or familial.

jake carries a green a yellow and a black guitar pic in his pocket. he randomly chooses a guitar pic from his pocket before every concert. what is the probabili

A position-time graph is shown for a motorcycle driving south. According to the graph, what is the motorcycle’s average velocity?A) 5 km/h southB) 24 km/h south

pls help me on history

Which sentence is written in the passive voice? A. Evangeline decided to read a book because her favorite show was not airing this evening. B. The childr

Need answer quick!!!!!! 20 Points!!!!!! Will give Branliest !!!!!!1 Which one of these exhibits a dorsal nerve chord at some stage of its development? a sna