4804378780 4804378780
  • 18-02-2021
  • Biology
contestada

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Respuesta :

malakmohammed0101 malakmohammed0101
  • 18-02-2021
CUGCUACAUCGUAGCUGGUAAC
Answer Link

Otras preguntas

Odysseus figures out two plans to trick the cyclops both plans rely on intellect rather then force which best states the theme that this develops
2/5+1/4+1/10= I need the answer
I need help solving (5-6x9+6)x9+3-85 I came up with -109. Is that right
Who is Paul Bunyan's best friend?
which part of the nephron conserves water and minimizes the volume of urine?
Which document puts you at the LEAST risk of identity theft?
Help please it is easy but I haven't ate dinner
Answer the question by adding adverbs The teacher gave the instructions(how?)
Students may be granted ____ fee waivers for the SAT and _____ fee waivers for the SAT Subject Tests.
(MC)Which statement describes the approach the Warren Court took to the issue of segregation? It declared segregation unconstitutional but ruled that integrat