Porrascastro23 Porrascastro23

16-11-2020
Mathematics

contestada

FREEEE POINTS cuz Y not and I feel like giving these to people so yea

Respuesta :

arilynn231 arilynn231

16-11-2020

Answer:

cool thanks

Step-by-step explanation:

Answer Link

brownlailam brownlailam

16-11-2020

Answer:

Step-by-step explanation:

thxxxxxxxxxxxxxxxxxxxxxxxxxxx

Answer Link

Otras preguntas

Coding of a Polypeptide by Duplex DNA The template strand of a segment of double-helical DNA contains the sequence (59)CTTAACACCCCTGACTTCGCGCCGTCG(39) (a) What

can someone find the slope and y intercept ?

Which number completes the table for y = x2?

A scientist used 786 milliliters of an liquid for an experiment. How many liquids of liter did the scientist to use for this experiment?

yo can someone help meeeee

Find the Molarity of 6.25 grams of barium nitrate dissolved in 250 mL solution.

Gloria’s washing machine is broken. Since her machine is pretty old, she doesn’t want to spend more than $100 for repairs. A service call will cost $35 and the

Tommy wanted a skateboard badly. Sometimes he would stay after school just to watch the older boys do tricks on the stairs. Tommy thought that it looked like so

TRUE OR FALSE: The parliament is not elected

The equation y = 0.625x – 2.7 can be used to predict the number of minutes, y, it takes Kahlil to check x emails. On Monday, Kahlil spent 25 minutes checking em