aspr0530 aspr0530

20-10-2020
Biology

contestada

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Respuesta :

cryork2015 cryork2015

20-10-2020

GTTCAAGCTACTGTTCAAGCTACT

Answer Link

Otras preguntas

which value is less than 1.25%

A flea feeds off the blood of a dog. The flea is able to obtain nutrients from the blood, but the dog can become anemic. What type of relationship is this? A. c

Find the sum 2/8 + 3/9

One way in which knights, samurai, and warlords are similar is that they all A. were traditional religious leaders B. occupied military posts in the Chinese Emp

The circle C has centre A(2,1) and passes through the point B(10,7). Find and equation for C

What is the lateral area of the rectangular prism with a base length of 17 m, a base width of 7 m, and a height of 5 m? A. 595 m2 B. 478 m2 C. 240 m2 D. 23

Which of the following are public health measures that have helped fight disease? A. labelling food supplies B. monitoring water supplies C. limiting vaccinatio

Write a story related to the points shown in each graph. Be sure to include a statement relating the numbers graphed on the number line to their order. i will

three(two squared minus9)

all of the following prevent pathogens from entering the human body except A. red blood cells B. tears C. mucus D. skin