queencottoncandy776
queencottoncandy776 queencottoncandy776
  • 18-08-2020
  • Mathematics
contestada

I answered all my work correctly but I don’t understand this one.

I answered all my work correctly but I dont understand this one class=

Respuesta :

greenmonkey04
greenmonkey04 greenmonkey04
  • 18-08-2020
Take your x values in each coordinate and subtract 2, and take your y values and subtract 1.

Q (0-2), (-1-1)
= (-2,-2)

D (-2-2), (2-1)
= (-4, 1)

V (2-2), (4-1)
= (0,3)

J (3-2), (0-1)
= (1,-1)

You can also draw it on a graph and then translate all coordinates 2 units left and 1 down to see the end results.
Answer Link

Otras preguntas

Least to greatest 2.8, -2 3/4, 3 1/8, -2.2
A machine can fill a box with twenty pencils in 30 seconds. How many boxes can the machine fill in 2 hours?
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
Which of the following is a track and field event: slalom, butterfly, or high jump?
x<4 on a number line please help
Read the poem. excerpt from “Spring” by Christina Rossetti Frost-locked all the winter, Seeds, and roots, and stones of fruits, What shall make their sap ascend
At a dog shelter a 24 pound of dog food will feed 36 dogs a day. How many dogs would you expect to feed with a 16 pound bag
The generals use news briefings often as a way to: a. communicate the purpose of the war c. dissect the strategy of war b. discuss events that are occurring
list and explain two historical examples of how the executive checked the legislative branch
Socialization does not determine a person���s level of self-control. true or false.