schumannruth04 schumannruth04

19-03-2020
History

contestada

How did the Berlin Airlift overcome the Berlin Blockade?

Respuesta :

1dariusduncan 1dariusduncan

19-03-2020

Answer:

the Soviets lifted the blockade and reopened the roads, canals and railway routes into the western half of the city

Explanation:

was one of the first major international crises of the Cold War.

Answer Link

Otras preguntas

Which figure of speech is summer in Sonnet 18?

Two vectors, of magnitudes 20 and 50, are added. Which one of the following is a possible answer for the magnitude of the resultant?

Which statement best demonstrates a difference between the young man’s and Sylvia’s values?

Express the words in excel formula The sum of sixty five plus one thousand fifty multiplied by three.

Transribe and translate the following dna strand GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

each multiwire branch circuit shall be provided with a means that will simultaneously disconnect all ungrounded conductors at the point where the branch circuit

3. Order the following from closest to farthest away from Earth: The Moon, Edge of the Universe, Mercury, Hubble Galaxy, Pluto's Moon, Milky Way Galaxy. Closest

Ingrid is buying a pair of pants with an original cost of c dollars. The pants are on sale for 15% off their original cost. which two calculations could Ingrid

if computer disks cost 69.95$ a dozen how much do 8 disks cost?

omicron subvariant xbb.1.5 possibly more likely to infect those who are vaccinated, officials say