katiefish05p5lgsw katiefish05p5lgsw

18-03-2019
Mathematics

contestada

Please help me because I hate life

Please help me because I hate life class=

Respuesta :

brock92 brock92

18-03-2019

The answer is the last one which is positive 6. I hate life too your not alone

Answer Link

Iriscultmember Iriscultmember

18-03-2019

It's -6

-6-4(-3)/-2+1

-4*-3=12

-6+12=6

-2+1=-1

6/-1=-6

Answer Link

Otras preguntas

Studies have found that a person is most likely to be involved in a fatal crash with an impaired driver during the hours of ________________.

Which types of electromagnetic waves have higher frequencies than the waves that make up ultraviolet light? Check all that apply.

A new economic downturn during Roosevelt's presidency was known to some as the Roosevelt Recession. TRUE OR FALSE

Which instrument was popularized during the classical period because of its responsive action and better gradual dynamics?

Can you exchange is $150 for British pounds. Suppose the conversion rate is £1=$1.60. How many pounds should she receive?

Identify a common reason teens report they start using alcohol

Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

which one of the following can we consider to be truly audiovisual?

A box contains 6 red balls and 5 green balls. three balls are selected at random from this box "with replacement". what is the probability that exctly two of th

4. If interest rates are at a level of 1% and expected inflation is 2%, would you prefer saving or spending your money?