asi3aLitFitroomihri asi3aLitFitroomihri

17-03-2016
Health

contestada

Approximately _____ Americans die as a result of HBV infection every year.

Respuesta :

JordanHatesMath JordanHatesMath

17-03-2016

after some quick research about what HBV was, i found that approximately 5,000 americans die each year from HBV contraction. hope this helps you :)

Answer Link

Otras preguntas

How many women worked in factories, shipyards, and other manufacturing plants during world war ii?

Which characteristic can be inherited? A long toes B short temper C sense of humor D acting ability

I do not get this at all!!!!!!!!

PLEASE HURRY AND HELP The idea that the South grew primarily cotton is a myth, they grew all of the following EXCEPT: a. rice c. tobacco b. textiles d. cotton

luna chose a card at random from a standard deck of 52 cards.What is the probability that she chose a spade greater than 10(j,q,k,a)

ROMEO: This gentleman, the prince's near ally, My very friend, hath got his mortal hurt In my behalf; my reputation stain'd With Tybalt's slander,—Tybalt, that

Which of the following statements about the use of desktop publishing software is true? A. There's no visible difference between pages produced by word

Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

which of the following is a good way to stay motivated and keep track of your thoughts and feelings throughout this class A.writing everything down in your fitn

Which of the following is NOT a benefit of safety and health programs?