dawgmaje3826 dawgmaje3826
  • 16-05-2023
  • Health
contestada

when bacteria are exposed to antibiotic medications, they can develop resistance so that the drugs no longer harm them. for this to occur, the bacteria must experience ____ followed by _____.

Respuesta :

Otras preguntas

The altitude of a triangle is increasing at a rate of 1 1 centimeters/minute while the area of the triangle is increasing at a rate of 1 1 square centimeters/mi
Where are coins manufactured?
Why did the number of workers in European textile mills increase
_____________ helped Argentinian people win independence from Spain. a. Toussaint L’Ouverture c. Simón Bolívar b. Miguel Hidalgo d. José de San Martín
Australia's interior contains very few population centers. The BEST explanation for this fact is Question 2 options: mountain ranges that seal it off from the
An item is advertised on sale at 85% off. To find the sales price, you multiply the original price by ____.
Charles darwin's on the origin of species has its strongest influence on the school of thought called
True or false? two or more atoms bonded together always form a compound. a. True b. False
What is 4/5 hour = Seconds
Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’