sharidler sharidler

16-12-2022
Biology

contestada

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTTTAATCGAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

Respuesta :

Otras preguntas

"Atticus killed the engine in the driveway and coasted to the carhouse". What does that mean? This is from To Kill a Mockingbird.

what was the effect when the english settlers were willing to fight for the land they wanted?

How can I write a story about the doubles plus 2 fact 5+7=12.??

what organ absorbs excess water from undigested food prior to its release from the body as a solid waste

Is 10/9 closest to 0, 1/2 or 1? Explain Is 2/15 closest to 0, 1/2 or 1? Explain

The landscape feature that forms when plate movement forces the crust to bend downward is a.......

which climate has no vegetation and his home to penguins and polar bears?

in kilometers how much larger is the distance around the earth from east to west than the distance from north to south

The largest side of a triangle is six more units than the smallest side. The third side is twice the smallest side. If the perimeter of the triangle is 25 uni

How do you change 45/117 to the simplest form?????